My friend asked me if we can plot a 3D model of DNA (deoxyribonucleic acid) in Mathematica. However, I am not really familiar with this and I don't know if Mathematica can do this. Could you answer the question or give me some ideas to do this? Thank you very much for your help!
-
2See: http://demonstrations.wolfram.com/DoubleHelix/ and https://reference.wolfram.com/language/ref/ProteinData.html – Baran Cimen May 19 '16 at 08:25
-
Thank you very much. I am trying that now. – emnha May 19 '16 at 09:16
3 Answers
The easiest way to do this is if you have a PDB file, then it's as easy as using Import. Here are a few examples from the RCSB's Protein Data Bank. To get the URLs, find a page for a given sequence or protein and right-click on the link next to "DOI:" and copy the link.
Import[#, "PDB"] & /@ {"http://files.rcsb.org/download/5ET9.pdb",
"http://files.rcsb.org/download/1BNA.pdb",
"http://files.rcsb.org/download/208D.pdb",
"http://files.rcsb.org/download/1D91.pdb",
"http://files.rcsb.org/download/5A0W.pdb"}
But wouldn't it be cool if you could just input a DNA sequence and have a plot? Well, I can't figure out how to get Mathematica to do that without outside help, but it can be done,
GenomeData[{"ChromosomeY", {99, 132}}]
(* "GCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCC" *)
Take that little snippet and paste it into the form on this site, then you can download a PDB file to import,
Theoretically, this could be incorporated into Mathematica since it is done using NAB, part of AmberTools, which are under a GNU license.
- 124,525
- 11
- 401
- 574
- 68,381
- 3
- 139
- 286
-
-
-
Could you tell me how did you know these files pdb? I tried to follow the link above but I didn't see any file like that. http://files.rcsb.org/download – emnha May 19 '16 at 09:51
-
2@anhnha - there is apparently an easier way to do it than what I did. Go to the link above, then click on one of the proteins, like this one. Right click on the link next to the DOI and copy the link location. Then just use that link, via
Import["http://dx.doi.org/10.2210/pdb2nba/pdb", "PDB"]– Jason B. May 19 '16 at 09:54 -
-
Something you might like: add
ColorFunction -> "Residue"to yourImport[]. – J. M.'s missing motivation May 20 '16 at 14:54 -
@J.M. You would think, right!? But check out
Graphics`MoleculePlotDump`residueColorRules, there's no "Gua" or "Ade" or "Cyt" on there, they are only listed by their 1-letter abbreviations, soImport["http://files.rcsb.org/download/5ET9.pdb", "PDB", ColorFunction -> "Residue"]fails – Jason B. May 20 '16 at 15:01 -
For that file at least, here is an ugly workaround:
With[{cols = Graphics`MoleculePlotDump`residueColorRules}, Internal`WithLocalSettings[Graphics`MoleculePlotDump`residueColorRules = Thread[{"DA", "DT", "DG", "DC"} -> {RGBColor[32/51, 32/51, 1], RGBColor[32/51, 1, 32/51], RGBColor[1, 112/255, 112/255], RGBColor[1, 28/51, 5/17]}], Import["http://files.rcsb.org/download/5ET9.pdb", "PDB", ColorFunction -> "Residue"], Graphics`MoleculePlotDump`residueColorRules = cols]]– J. M.'s missing motivation May 21 '16 at 17:02
This was supposed to be a comment to Jason's answer, but it got a bit long.
But wouldn't it be cool if you could just input a DNA sequence and have a plot? ... take that little snippet and paste it into the form on this site, then you can download a PDB file to import...
By looking through the source of the make-na server form, I was able to figure out what to pass into the page's CGI and how to pass them via URLExecute[]. Here is what I came up with:
Options[MakeDNA] = {Background -> White, ColorFunction -> "Residue", "HelixType" -> "A",
ImageSize -> Automatic, "Hydrogens" -> False,
"Rendering" -> "Structure", "SingleStranded" -> False,
ViewPoint -> Automatic};
MakeDNA[seq_String, opts : OptionsPattern[]] := Module[{params},
params = {"distro" -> "make-na", "seq_name" -> "0",
"helix_type" -> OptionValue["HelixType"],
"f_acid_type" -> "dna", "r_acid_type" -> "dna", "description" -> seq,
"file_type" -> "pdb", "f_cid" -> "A", "r_cid" -> "B",
"f_first_num" -> 1, "r_first_num" -> 1, "sugar_indi" -> "asterisk",
"hydrogens" -> If[TrueQ[OptionValue["Hydrogens"]], "yes", "no"],
"f_codelen" -> 1, "r_codelen" -> 1};
If[TrueQ[OptionValue["SingleStranded"]],
AppendTo[params, "single_strand" -> "SS"]];
ImportString[URLExecute["http://structure.usc.edu/cgi-bin/make-na/make-na.cgi",
params, "String", Method -> "POST"], "PDB",
FilterRules[Join[{opts}, Options[MakeDNA]],
{Background, ColorFunction, ImageSize,
"Rendering", ViewPoint}]]]
Most of the parameters are set to their defaults on the web form; see this page for sundry instructions on how to set them, as well as how to specify the input nucleic acid sequence (e.g. 5' -> 3', if you are specifying only one strand) and the limitations of the service.
Here are some examples:
MakeDNA["ATACCGATACGATAGAC"]

MakeDNA["ATACCGATACGATAGAC", "HelixType" -> "SB", "SingleStranded" -> True,
"Rendering" -> "Wireframe"]

It should not be too hard to modify/generalize this function so that it can also return RNA models.
- 124,525
- 11
- 401
- 574
-
-
That is great!! I was trying to do this but couldn't quite figure it out – Jason B. May 21 '16 at 18:01
-
@J.M. - is this site down for good, or am I just having trouble with it at the moment? – Jason B. Mar 05 '18 at 22:41
-
@Jason, it seems kaput, and the author has not given any updates. At worst, one may have to write an interface to NAB from scratch. – J. M.'s missing motivation Mar 05 '18 at 23:25
Here is a function that can wrap a double helix around any (sufficiently smooth) parameterized curve. Among other things, the function below computes a Bishop frame along the curve; twisting it leads essentially to the double helices. In principle, the Bishop frame can be used to transport arbitrary geometric objects along the curve.
ClearAll[MakeDNA];
SetAttributes[MakeDNA, HoldAll]
MakeDNA[DNAcode_, curve_, {t_, a_, b_}, OptionsPattern[{
"HelixRadius" -> 0.125,
"HelixFrequency" -> 4,
"SingleStranded" -> False,
"LineThickness" -> .1,
"StartingFrameVector" -> Automatic
}]] :=
Module[{γ},
Block[{charlist, ω, T, κ, A, frame, frame1, frame2,
eq, sol, δ1, δ2, col, opp, piece, line, mlist, n,
tlist, s, r, θ, u0},
γ = s \[Function] Evaluate[Evaluate[curve] /. t -> s];
r = OptionValue["HelixRadius"];
θ = OptionValue["LineThickness"];
charlist = Characters[DNAcode];
n = Length[charlist];
tlist = Subdivide[a, b, n];
(* unit tangent vector *)
T = t \[Function] Evaluate[γ'[t]/Sqrt[γ'[t].γ'[t]]];
(* curvature vector *)
κ = t \[Function] Evaluate[T'[t]/Sqrt[γ'[t].γ'[t]]];
(* compute Bishop frame *)
u0 = OptionValue["StartingFrameVector"];
If[! VectorQ[u0],
u0 = IdentityMatrix[3][[Ordering[Abs[γ'[0]], 1][[1]]]];
];
A = t \[Function]
Evaluate[
Array[ToExpression["a" <> ToString[#1] <> ToString[#2]][
t] &, {3, 3}]];
sol = NDSolve[
Evaluate@Thread[Flatten[{A'[t][[1]] - Sqrt[γ'[t].γ'[t]] (A[t][[2]] A[t][[2]].κ[t] + A[t][[3]] A[t][[3]].κ[t]), A'[t][[2]] + Sqrt[γ'[t].γ'[t]] (A[t][[1]] A[t][[2]].κ[t]), A'[t][[3]] + Sqrt[γ'[t].γ'[t]] (A[t][[ 1]] A[t][[3]].κ[t]), A[0] - Orthogonalize[{T[0], u0, Cross[T[0], u0]}] }] == 0],
Evaluate[Flatten[A[t]]],
{t, a, b}
][[1]];
frame = t \[Function] Evaluate[A[t] /. sol];
(*angle correction so that DNA closes*)
ω = OptionValue["HelixFrequency"];
If[(Norm[γ[a] - γ[b]] < 10^-8) && (Norm[γ'[a] - γ'[b]] < 10^-8),
ω -= ArcTan @@ LinearSolve[Transpose[frame[b]], Transpose[frame[a]]][[2, 2 ;; 3]]/(b - a)/(2 Pi);
];
frame1 = t \[Function] {
frame[t][[1]],
frame[t][[2]] Cos[2 Pi ω t] + frame[t][[3]] Sin[2 Pi ω t],
-frame[t][[2]] Sin[2 Pi ω t] + frame[t][[3]] Cos[2 Pi ω t]
};
frame2 = t \[Function] {
frame[t][[1]],
-(frame[t][[2]] Cos[2 Pi ω t] + frame[t][[3]] Sin[2 Pi ω t]),
frame[t][[2]] Sin[2 Pi ω t] - frame[t][[3]] Cos[2 Pi ω t]
};
(* the actual helices *)
δ1 = t \[Function] γ[t] + r frame1[t][[2]];
δ2 = t \[Function] γ[t] + r frame2[t][[2]];
piece["A"] = {p, frame, scale} \[Function] {col["A"], Specularity[White, 30], Tube[{p, p - r frame[[2]]}, scale r/2]};
piece["C"] = {p, frame, scale} \[Function] {col["C"], Specularity[White, 30], Tube[{p, p - r frame[[2]]}, scale r/2]};
piece["G"] = {p, frame, scale} \[Function] {col["G"], Specularity[White, 30], Tube[{p, p - r frame[[2]]}, scale r/2]};
piece["T"] = {p, frame, scale} \[Function] {col["T"], Specularity[White, 30], Tube[{p, p - r frame[[2]]}, scale r/2]};
line = {p1, p2, c, scale} \[Function] {col[c], Tube[{p1, p2}, scale r/2]};
col["A"] = Darker@Darker@Blue;
col["T"] = Orange;
col["C"] = Darker@Darker@Green;
col["G"] = Darker@Red;
opp["A"] = "T";
opp["T"] = "A";
opp["G"] = "C";
opp["C"] = "G";
mlist = MovingAverage[tlist, 2];
Show[
Graphics3D[{
Table[piece[charlist[[i]]][δ1[mlist[[i]]], frame1[mlist[[i]]], θ], {i, 1, n}],
Table[line[δ1[tlist[[i]]], δ1[tlist[[i + 1]]], charlist[[i]], 2 θ], {i, 1, n}],
If[! TrueQ[OptionValue["SingleStranded"]],
{
Table[piece[opp@charlist[[i]]][δ2[mlist[[i]]], frame2[mlist[[i]]], θ], {i, 1, n}],
Table[line[δ2[tlist[[i]]], δ2[tlist[[i + 1]]], opp@charlist[[i]], 2 θ], {i, 1, n}]
}
]
}
],
Lighting -> "Neutral"
]
]
]
Some basic examples:
DNAcode = StringJoin[RandomChoice[{"A", "C", "G", "T"}, {720}]]
γ = t \[Function] {Cos[2 Pi t], Sin[2 Pi t], 0.5 t};
MakeDNA[DNAcode, γ[t], {t, -2, 2},
"SingleStranded" -> False,
"HelixFrequency" -> 16,
"HelixRadius" -> 0.1
]
As I said, the curve can be quite arbitrary:
γ = With[{data = DataPaclets`KnotDataDump`RawKnotData[
KnotData["Stevedore", "AlexanderBriggsList"],
"GraphicsData"
]},
BSplineFunction[
data[[1]].DiagonalMatrix[data[[3]]],
SplineClosed -> True,
SplineDegree -> 3
]
];
DNAcode = StringJoin[RandomChoice[{"A", "C", "G", "T"}, {720}]]
g = MakeDNA[DNAcode, γ[t], {t, 0, 1},
"SingleStranded" -> False,
"HelixFrequency" -> 36,
"HelixRadius" -> 0.025
]
- 124,525
- 11
- 401
- 574
- 106,770
- 7
- 179
- 309
-
Very nice! But I must note something in your definition of
opp: the opposite of"A"should be"T", and the opposite of"G"should be"C". – J. M.'s missing motivation Mar 10 '18 at 22:10 -
1Wow, some read the code very carefully... Thanks for the hint! I fixed it. – Henrik Schumacher Mar 11 '18 at 00:34
-
Also, there is this paper that claims to combine the best aspects of the Frenet-Serret and Bishop frames, but I haven't had the time to investigate. – J. M.'s missing motivation Mar 11 '18 at 00:36
-
1@HenrikSchumacher this is awesome, I have to say this. Just....wow. – CA Trevillian Jun 28 '19 at 19:43
-



