0

If I have genome coordinates is there a simple way to download the entire intervening sequence from the UCSC genome browser? I found some fancy way of using ftp but I can't figure it out.

The Nightman
  • 1,836
  • 1
  • 16
  • 28

2 Answers2

1

Yes. Table browser allows you to do that.

In the dropdown box called output format select sequence and click the button named get output. You'll get the sequence.

If you don't think it works then this is the output that I am getting. (Fist few lines):

>hg19_gold_AL096773.6 range=chr1:115207623-115347729 5'pad=0 3'pad=0 strand=- repeatMasking=none
GATCTGCCAGCGTCCACCTCCCGAGGTGCCGGGATTGCAGACGGAGTCTG
GTTCACTCAGTGCTCAATGGTGCCCAGGCTGGAGTGCAGTGGCGTGATCT
CGGCTCGCTACAACCTCCACCTCCCAGCCGCCTGCCCTGGCCTCCCAAAG
TGCCGAGATTGCAGCCTCTGCCCAGCCGCCACCCCGTCTGGGAAGTGAGG
AGCATCTCTGCCTGGCCGCCCATCATCTGGGATGTGAGGAGCCCCTCTGC
CTGGCTGCCCAGTCTGGGAAGTGAGGAGCGCCTCTTCCCGGCCGCCATCC

Actually Table browser is quite useful as you can get different kinds of data for a given genomic region which include annotations, variation, transcription factor binding sites etc.

WYSIWYG
  • 35,564
  • 9
  • 67
  • 154
  • Actually this does not seem to give me intervening sequence for coordinates. (I'm trying this: chr1:115227814-115227978) It just outputs some coordinates. – The Nightman Sep 18 '15 at 20:07
  • @TheNightman In the dropdown box called output format select sequence and click the button named get output. You'll get the sequence. – WYSIWYG Sep 18 '15 at 22:14
1

I did find a way of doing this using UCSC das. If the pertinent info is changed in the page address here, it will output the intervening sequence between two locations:

http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chr1:100,200

The Nightman
  • 1,836
  • 1
  • 16
  • 28