0

I have came across a few genes that show different nucleotide sequence in different databases. I then found out that the sequences are actually reverse complement of each other. How do i determine which is the actual nucleotide sequence of a gene,and not the reverse complement version of it?

Skyd4ncer
  • 25
  • 2
  • 2
    Usually the reported sequence for a mRNA in NCBI is the sense strand. Can you give an example of a gene whose sequence you are unsure of? – WYSIWYG Apr 30 '18 at 09:28
  • 2
    Possible duplicate of What direction is a sequence in databases written? – David Apr 30 '18 at 11:41
  • Hi @WYSIWYG below are the nucleotide sequences of the rplC gene. The first one is from NCBI, while the second I received from a sequencing company for my strain:

    ATCC 19977 R rplC ncbi

    CTACTTCTCACCTCGCTTGACAGCGGTGCGGACCACAACCAAGCCACCCTTACGTCCGGGGATGGCACCC TTGATCAGCAGTACGCCGTTCTCGGCATCGACCTTGTGCACCACCAGGTTCTGAGTGGTGACGCGATCGC TACCCATACGTCCGGACATCCGGGTGC

    M61 S

    ATGGCAAGAAAAGGAATTCTGGGCACCAAGCTGGGTATGACGCAGGTGTTCGACGACAAC AACCGGGTTGTCCCGGTAACCGTCGTCAAGGCCGGCCCCAATGTGGTGACCCGCATCCGG ACCACCGAGCAGGACGGCTACAGCGCCGTGCAGCTCGCGTATGGCGAGATCAGCCCCCGC AAGGTGACCAAGCCGGTCACCGGTCAGTTCGCCGCCGCGGGC

     – Skyd4ncer May 02 '18 at 07:06
  • It's really important for me to know the exact sequence, as i am looking for a nucleotide change at a specific location – Skyd4ncer May 02 '18 at 07:10

2 Answers2

0

You run a blast of your sequence. Then explore the results and you'll see somewhere that says "strand" and is indication whether is plus/minus.

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Also blast has a graphical interface in which you'll clearly see the matching and non-matching bases. Therefore it should help you to identify the differences between the 2 sequences.

aLbAc
  • 292
  • 1
  • 11
0

In general, if you look up a transcript sequence it will be in the correct orientation. If you look up a gene based on genomic coordinates, it may not be.

We can't tell you why your first sequence is in the wrong orientation from what you pasted.

swbarnes2
  • 5,230
  • 15
  • 14