0

I am an ECE student, and i am doing my project

I want to generate a code for gabor wavelet transform. I have no idea could you help me with a sample program

I have DNA as input sequences and how can use it as input data

"sample sequence s={ACGTACGTACCCCAGGGATTT} "

thanks and regards!

chrish
  • 11

2 Answers2

2

You're probably way out of your league if you have these problems, and just getting code won't help you with your project. your teacher will spot rather quickly that you didn't write it.

To start, you should read up on wavelet transforms in general. Gabor wavelets are just a specific kind.

You'll learn that wavelet transforms work on signals. That means you'll need to represent your DNA as a signal, i.e numbers.

MSalters
  • 821
  • 4
  • 11
1

May I suggest an illustrative example which should guide you in the beginning ?

As noted you can't obtain any results using the given DNA sequence as it is. Instead you should transform it and what more natural than assigning integer values to each nucleobase ?

data = {A, C, G, T, A, C, G, T, A, C, C, C, C, A, G, G, G, A, T, T, T} /. 
        {A -> 1, G -> 2, T -> 3, C -> 4};

cwd = ContinuousWaveletTransform[data, GaborWavelet[]]

WaveletScalogram[cwd, ImageSize -> 500, ColorFunction -> "DeepSeaColors"]

Mathematica graphics

Or if you need a finer resolution

ListDensityPlot[Abs@Reverse@cwd[All, "Values"], ColorFunction -> "DeepSeaColors"]

Mathematica graphics

You can always observe the scalogram in 3D

f = cwd["LinearScalogramFunction"]

(* Real Part *)
Plot3D[Re@f[x, y], {x, 1., 21.}, {y, 1.15117, 7.74411}, ImageSize -> 500,
            ColorFunction -> "SunsetColors"]

Mathematica graphics

(* Imaginary part *)
Plot3D[Im@f[x, y], {x, 1., 21.}, {y, 1.15117, 7.74411}, ImageSize -> 500,
            ColorFunction -> "SunsetColors"]

Mathematica graphics

I will leave the interpretation of the scalograms to you.

Sektor
  • 310
  • 3
  • 6