Highlight text with \fcolorbox without space

Question

I wanted to highlight part of my sequence. The problem is that \fcolorbox shifts the text so that the sequences are no longer aligned.

\documentclass{article}
\usepackage[dvipsnames]{xcolor}
\newcommand{\cbox}[1]{\fcolorbox{red!80}{yellow}{#1}}
\begin{document}
    \begin{table}[]
    %   \caption{}
        %\label{tab:my-table}
        \begin{tabular}{ll}
            Seq1 & gactttgtggacatcaacgtcggc\cbox{tgc}cccatcgacctcgtgtac \
            Seq2 & gactttgtggacatcaacgtcggctgccccatcgacctcgtgtac \
            Seq3 & gactttgtggacatcaacgtcggctgccccatcgacctcgtgtac \
            & *****************************************

        \end{tabular}
    \end{table}
\end{document}

How can I remove the space inserted by the \fcolorbox ?

PS: \makebox() did not help.

Werner · Accepted Answer · 2021-11-09T05:06:55.063

You can remove the impact of the space and rule inserted around the box:

\documentclass{article}
\usepackage{xcolor,array}
\newcommand{\cbox}[1]{{%
  \setlength{\fboxsep}{-\fboxrule}% Remove impact of space and rule inserted by box
  \fcolorbox{red!80}{yellow}{\strut#1}%
}}
\begin{document}
\begin{tabular}{ l >{\ttfamily} l }
  Seq1 & gactttgtggacatcaacgtcggc\cbox{tgc}cccatcgacctcgtgtac \
  Seq2 & gactttgtggacatcaacgtcggctgccccatcgacctcgtgtac \
  Seq3 & gactttgtggacatcaacgtcggctgccccatcgacctcgtgtac \
       & *********************************************
\end{tabular}
\end{document}

You can also set the \fcolorbox in the background by capturing the position of the text (using zref's savepos module) and placing a \phantom element via eso-pic.

\documentclass{article}
\usepackage{xcolor,array,zref-savepos,eso-pic}
\newcounter{cboxcntr}
\newcommand{\cbox}[1]{{%
  \stepcounter{cboxcntr}% Allow for unique \cbox
  \zsavepos{cbox-\thecboxcntr}% Capture (x,y) coordinate of cbox
  #1%
  \begingroup
  \edef\x{\endgroup\noexpand\AddToShipoutPictureBG{%
    \noexpand\AtPageLowerLeft{%
      \noexpand\setlength{\noexpand\fboxsep}{.5\noexpand\fboxsep}% Reduce the fbox padding
      \noexpand\hspace{\dimexpr\zposx{cbox-\thecboxcntr}sp-\fboxsep-\fboxrule}%
      \noexpand\raisebox{\zposy{cbox-\thecboxcntr}sp}{%
        \noexpand\fcolorbox{red!80}{yellow}{\noexpand\phantom{\noexpand\ttfamily\noexpand\strut#1}}%
      }%
    }%
  }}\x%
}}
\begin{document}
\begin{tabular}{ l >{\ttfamily} l }
  Seq1 & gactttgtggacatcaacgtcggc\cbox{tgc}cccatcgacctcgtgtac \
  Seq2 & gactttgtgg\cbox{aca}tcaacgtcggctgccccatcgacctcgtgtac \
  Seq3 & gactttgtggacatcaacgtcggctgccccatcgac\cbox{ctcg}tgtac \
       & *********************************************
\end{tabular}
\end{document}

score 3 · Answer 2 · answered Nov 09 '21 at 04:26

My answer is inspired to this one.

With this code (where I changed the color for more readability):

\documentclass{article}
\usepackage[dvipsnames]{xcolor}
\usepackage{soul}
\newcommand{\hlc}[2][yellow]{{%
        \colorlet{foo}{#1}%
        \sethlcolor{foo}\hl{#2}}%
}
\newcommand{\mybox}[1]{\hlc[red!40!yellow]{#1}}
\begin{document}
    \begin{table}[]
        %   \caption{}
        %\label{tab:my-table}
        \begin{tabular}{ll}
            Seq1 & gactttgtggacatcaacgtcggc\mybox{tgc}cccatcgacctcgtgtac \
            Seq2 & gactttgtggacatcaacgtcggctgccccatcgacctcgtgtac \
            Seq3 & gactttgtggacatcaacgtcggctgccccatcgacctcgtgtac \
            & *****************************************

        \end{tabular}
    \end{table}
\end{document}

You have the desired result:

Highlight text with \fcolorbox without space

2 Answers2