I am trying to create a long table that will be multicolumn.
In one of the columns, I have a DNA sequence that is very long.
I am trying to use the \multicolumn but the text is not wrapping possibly because it treats the DNA sequence as one word so the word continues and overflows into the next column.
Also I do not want to introduce either hypher or next line to my DNA sequence.
Please help.
TIA
My code gives me this output
\documentclass{report}
\usepackage{array}
\usepackage{longtable}
\begin{document}
\begin{longtable}{c c c}
\caption {Primers}\\
Code & Sequence (5' to 3') & Use \\
D10520 &CCCTGCGGTGCCCCTCAAG &\multicolumn{1}{m{6cm}}{Anneals upstream of the EcoRI site in pRW50/ PRW224/pRW225. Used for sequencing and amplification of inserts in this vector.}\\
D812443 &\multicolumn{1}{m{6cm}}{GGGGGGGAATTCGTCTGCACAGTGGTGTTTATTTATCTTTTTAGTAACTTTGTTTTAAGTCGCATATTAAC} &\multicolumn{1}{m{6cm}}{aafD upstream primer containing an EcoRI site for amplification of aafD96-65C promoter fragment.}
\end{longtable}
\end{document}
