2

I am trying to create a long table that will be multicolumn. In one of the columns, I have a DNA sequence that is very long. I am trying to use the \multicolumn but the text is not wrapping possibly because it treats the DNA sequence as one word so the word continues and overflows into the next column. Also I do not want to introduce either hypher or next line to my DNA sequence. Please help. TIA My code gives me this outputenter image description here

\documentclass{report}

\usepackage{array}
\usepackage{longtable}

\begin{document}
    \begin{longtable}{c c c}
\caption {Primers}\\
Code & Sequence (5' to 3') & Use \\



D10520 &CCCTGCGGTGCCCCTCAAG &\multicolumn{1}{m{6cm}}{Anneals upstream of the EcoRI site in pRW50/ PRW224/pRW225. Used for sequencing and amplification of inserts in this vector.}\\

D812443 &\multicolumn{1}{m{6cm}}{GGGGGGGAATTCGTCTGCACAGTGGTGTTTATTTATCTTTTTAGTAACTTTGTTTTAAGTCGCATATTAAC} &\multicolumn{1}{m{6cm}}{aafD upstream primer containing an EcoRI site for amplification of aafD96-65C promoter fragment.}
\end{longtable}
\end{document}
Mico
  • 506,678
Ziprip
  • 23

1 Answers1

2

Instead of using c as the main column type for all three columns, you may want to think about using l for the first column and p for the second and third columns. That way, you can save yourself a lot of \multicolumn{1}{..}{...} statements in the body of the table.

Combining this idea with the \seqsplit macro for the long character sequences, along with providing a bit more structure to the longtable, yields:

enter image description here

\documentclass{report}

\usepackage{array,longtable,booktabs,ragged2e}
\usepackage{seqsplit} % for \seqsplit macro

\begin{document}
\begin{longtable}{@{} l p{5cm} >{\RaggedRight\arraybackslash}p{4cm} @{}}
\caption{Primers}\\
\toprule
Code & Sequence (5' to 3') & Use \\
\midrule
\endhead
\bottomrule
\endfoot

D10520  
&\seqsplit{CCCTGCGGTGCCCCTCAAG}
&Anneals upstream of the EcoRI site in pRW50\slash PRW224\slash pRW225. 
Used for sequencing and amplification of inserts in this vector.\\ 
\addlinespace

D812443 
&\seqsplit{GGGGGGGAATTCGTCTGCACAGTGGTGTTTATTTATCTTTTTAGTAACTTTGTTTTAAGTCGCATATTAAC}
&aafD upstream primer containing an EcoRI site for amplification of 
 aafD96-65C promoter fragment.\\

\end{longtable}
\end{document}
Mico
  • 506,678